View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16465_low_8 (Length: 293)

Name: NF16465_low_8
Description: NF16465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16465_low_8
NF16465_low_8
[»] chr2 (1 HSPs)
chr2 (21-279)||(38365338-38365597)


Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 21 - 279
Target Start/End: Complemental strand, 38365597 - 38365338
Alignment:
21 gtacggcgaggctgaaggagacggtagcagaggtaaattctaaaatctaaataataactggctgagaagactcgatgaattaaattttaagtatagcact 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38365597 gtacggcgaggctgaaggagacggtagcagaggtaaattctaaaatctaaataataactggctgagaagactcgatgaattaaattttaagtatagcact 38365498  T
121 tatagtagagtattctttttatatcgg-nnnnnnngttttactaataaccgtggtattaacgatcattttgcaactatctttgagatttgaactctagct 219  Q
    |||||||||||||||||||||||||||        |||||| ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||    
38365497 tatagtagagtattctttttatatcggaaaaaaaagttttattaataaccgtggtattaaccatcattttgcaactatctttgaaatttgaactctagct 38365398  T
220 ttaaaatatgaactatgtcactctcactttctaaatatattactaatatcataatgtgtc 279  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38365397 ttaaaatatgaactatgtcactctcactttctaaatatattactaatatcataatgtgtc 38365338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University