View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16465_low_8 (Length: 293)
Name: NF16465_low_8
Description: NF16465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16465_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 21 - 279
Target Start/End: Complemental strand, 38365597 - 38365338
Alignment:
| Q |
21 |
gtacggcgaggctgaaggagacggtagcagaggtaaattctaaaatctaaataataactggctgagaagactcgatgaattaaattttaagtatagcact |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38365597 |
gtacggcgaggctgaaggagacggtagcagaggtaaattctaaaatctaaataataactggctgagaagactcgatgaattaaattttaagtatagcact |
38365498 |
T |
 |
| Q |
121 |
tatagtagagtattctttttatatcgg-nnnnnnngttttactaataaccgtggtattaacgatcattttgcaactatctttgagatttgaactctagct |
219 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38365497 |
tatagtagagtattctttttatatcggaaaaaaaagttttattaataaccgtggtattaaccatcattttgcaactatctttgaaatttgaactctagct |
38365398 |
T |
 |
| Q |
220 |
ttaaaatatgaactatgtcactctcactttctaaatatattactaatatcataatgtgtc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38365397 |
ttaaaatatgaactatgtcactctcactttctaaatatattactaatatcataatgtgtc |
38365338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University