View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16465_low_9 (Length: 245)
Name: NF16465_low_9
Description: NF16465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16465_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 153 - 229
Target Start/End: Original strand, 2566023 - 2566099
Alignment:
| Q |
153 |
aagtattcattaattaacaactaatccagttgagattcaaatagattagattatataaataaagtagccgtaaatca |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2566023 |
aagtattcattaattaacaactaatccagttgagattcaaatagattagattatataaataaagtagccgtaaatca |
2566099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 49 - 114
Target Start/End: Original strand, 2565960 - 2566025
Alignment:
| Q |
49 |
ttgaattttgcacaaatcttaacaagactattgaatgaatctacaacatcaataaatacaatgaag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2565960 |
ttgaattttgcacaaatcttaacaagactattgaatgaatctacaacatcaataaatacaatgaag |
2566025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University