View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16466_high_6 (Length: 321)
Name: NF16466_high_6
Description: NF16466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16466_high_6 |
 |  |
|
| [»] scaffold0008 (3 HSPs) |
 |  |  |
|
| [»] scaffold0251 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0008 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 43 - 297
Target Start/End: Original strand, 261703 - 261957
Alignment:
| Q |
43 |
atctgaaaatgtggaagagaattcactagatgatgaaaatggggataatggaccattggtgtctgagatttgggagttagctggaggggtaatttggtaa |
142 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||||||||| || |||||| ||| |||||||||||| || |||||||||||||||||||| |
|
|
| T |
261703 |
atctgaagaggtggaagagatttcactagatgatgaaaatggggataaagggccattgttgtttgagatttgggaactatctggaggggtaatttggtaa |
261802 |
T |
 |
| Q |
143 |
ttcgatatatctctcccttgtgtggattcaattatgtcttttgatttggtggatttagtttcttcatttgtgactatgttatttatagctctcttcttga |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
261803 |
ttcgatatatctctcccttgtgtggattcaattatgtcttttgatttggtggatttagtttcttcatttgtgacaatgttatctatagctctcttcttga |
261902 |
T |
 |
| Q |
243 |
gggaagtgtgccagtggttcttcacttcattatctgttcttccaggtaactcggc |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
261903 |
gggaagtgtgccagtggttcttcacttcattatctgttcttccaggtaactcggc |
261957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 15 - 170
Target Start/End: Original strand, 236822 - 236977
Alignment:
| Q |
15 |
caaaatcatccaaagtagtggaactgtgatctgaaaatgtggaagagaattcactagatgatgaaaatggggataatggaccattggtgtctgagatttg |
114 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
236822 |
caaaatcatccaaagcagtggaattgtgatctgaagatgtggaagataattcactagatgatgaaaatggggataaagggccattggtgtctgagatttg |
236921 |
T |
 |
| Q |
115 |
ggagttagctggaggggtaatttggtaattcgatatatctctcccttgtgtggatt |
170 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||| | ||||||||||||||||| |
|
|
| T |
236922 |
ggagttagctggaagggtaatttggtaattggatacacatctcccttgtgtggatt |
236977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #3
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 191 - 300
Target Start/End: Original strand, 236971 - 237080
Alignment:
| Q |
191 |
gtggatttagtttcttcatttgtgactatgttatttatagctctcttcttgagggaagtgtgccagtggttcttcacttcattatctgttcttccaggta |
290 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
236971 |
gtggatttggtttcttcatttgtgacaatgttatctatagctctcttcttgagggaagtgtgccagtggttcttcacttcattatctgttcttccaggta |
237070 |
T |
 |
| Q |
291 |
actcggccgc |
300 |
Q |
| |
|
|||||||||| |
|
|
| T |
237071 |
actcggccgc |
237080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0251 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: scaffold0251
Description:
Target: scaffold0251; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 235 - 300
Target Start/End: Complemental strand, 10070 - 10005
Alignment:
| Q |
235 |
cttcttgagggaagtgtgccagtggttcttcacttcattatctgttcttccaggtaactcggccgc |
300 |
Q |
| |
|
|||||| |||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10070 |
cttctttagggaagtatgccaatagttcttcacttcattatctgttcttccaggtaactcggccgc |
10005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0251; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 15 - 138
Target Start/End: Complemental strand, 10284 - 10158
Alignment:
| Q |
15 |
caaaatcatccaaagtagtggaactgtgatctgaaaa---tgtggaagagaattcactagatgatgaaaatggggataatggaccattggtgtctgagat |
111 |
Q |
| |
|
|||||||||||| | ||||| ||||||||||||| | ||| |||||||||||||||||||| |||| |||||| ||||| ||| || | ||| | | |
|
|
| T |
10284 |
caaaatcatccacataagtggtactgtgatctgaataatctgtagaagagaattcactagatgaagaaagtggggaaaatgggccagtgatatctagggt |
10185 |
T |
 |
| Q |
112 |
ttgggagttagctggaggggtaatttg |
138 |
Q |
| |
|
|||||| ||||||||||||||| ||| |
|
|
| T |
10184 |
ttgggaactagctggaggggtaacttg |
10158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 154 - 220
Target Start/End: Complemental strand, 2685211 - 2685145
Alignment:
| Q |
154 |
tctcccttgtgtggattcaattatgtcttttgatttggtggatttagtttcttcatttgtgactatg |
220 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
2685211 |
tctcccttgtgtgaattcaattatgtcctttgatttggtggatttcatttcttggtttgtgactatg |
2685145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 154 - 220
Target Start/End: Original strand, 5478101 - 5478167
Alignment:
| Q |
154 |
tctcccttgtgtggattcaattatgtcttttgatttggtggatttagtttcttcatttgtgactatg |
220 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
5478101 |
tctcccttgtgtgaattcaattatgtcctttgatttggtggatttcatttcttggtttgtgactatg |
5478167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 154 - 220
Target Start/End: Complemental strand, 45008636 - 45008570
Alignment:
| Q |
154 |
tctcccttgtgtggattcaattatgtcttttgatttggtggatttagtttcttcatttgtgactatg |
220 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
45008636 |
tctcccttgtgtgaattcaattatgtcctttgatttggtggatttcatttcttggtttgtgactatg |
45008570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University