View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16467_low_7 (Length: 255)
Name: NF16467_low_7
Description: NF16467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16467_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 48 - 110
Target Start/End: Original strand, 7951440 - 7951502
Alignment:
| Q |
48 |
caatgcgccaaatttgatttcttttgcgagattggtttcgggtccttttcttggatggtaagt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7951440 |
caatgcgccaaatttgatttcttttgcgagattggtttcgggtccttttcttggatggtaagt |
7951502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 7951582 - 7951636
Alignment:
| Q |
187 |
aggatgattgtgaatgatatgtatacttcagctatggtggggttggctatctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7951582 |
aggatgattgtgaatgatatgtatacttcagctatggtggggttggctatctctg |
7951636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University