View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16468_low_25 (Length: 239)
Name: NF16468_low_25
Description: NF16468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16468_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 23 - 229
Target Start/End: Complemental strand, 47735923 - 47735724
Alignment:
| Q |
23 |
tttgtgctgtgcctcccactctgccatcatgtttggctattgcaattgtttattttaaatactctttcatttcactattctcatgccatgcattttcatg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735923 |
tttgtgctgtgcctcccactctgccatcatgtttggctattgcaattgttaattttaaatactctttcatttcactattctcatgccatgcattttcatg |
47735824 |
T |
|
| Q |
123 |
cctataattgcctctatattattagtatcctttatactctcttccttcataaataactttactttatagccctttaactcaatttaatccaactcgatct |
222 |
Q |
| |
|
|||||||||| ||||||||| || ||| ||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47735823 |
cctataattggctctatattttt-------gttacactctctcccttcataaataactttactttgtagccctttaactcaatttaatccaactcgatct |
47735731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University