View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1646_low_6 (Length: 282)
Name: NF1646_low_6
Description: NF1646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1646_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 37027951 - 37028227
Alignment:
| Q |
1 |
actcataagaagccaccacaatatgctatttggtgtgtggcaaagcctacagttcctgatcctataattcaagtggctatggactatgcctgtgggtctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37027951 |
actcataagaagccaccacaatatgctatttggtgtgtggcaaagcctacagttcctgatcctataattcaagtggctatggattatgcctgtgggtctg |
37028050 |
T |
 |
| Q |
101 |
gggctgactgtaaatcagttcagcctaatgggatatgctttcagcccaacacagtgttggcacatgcttcttatgcattcaatagctattggcagaacac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37028051 |
gggctgactgtaaatcagttcagcctaatgggatatgctttcagcccaacacagtgttggcacatgcttcttatgcatttaatagctattggcagaacac |
37028150 |
T |
 |
| Q |
201 |
taagattggtggggggacttgtgattttggtggtactgctatgcttgtcactgttgatccaagtaagtttgcactac |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37028151 |
taagattggtggggggacttgtgattttggtggtactgctatgcttgtcactgttgatccaagtaagtttgcactac |
37028227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University