View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16470_high_6 (Length: 338)
Name: NF16470_high_6
Description: NF16470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16470_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 55 - 292
Target Start/End: Original strand, 38414725 - 38414967
Alignment:
| Q |
55 |
ttttaagagagtcgattgtcaagttctaagtgcatgacgtgagtttatatgcgcgtcatgtgtgag-gattaagatcctctccatttataactttttaga |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
38414725 |
ttttaagagagtcgattgtcaagttctaagtgtgtgacgtgagttcgtatgcgcgtcatgtgtgagaggttaagatcctctccatttataactttttaga |
38414824 |
T |
 |
| Q |
154 |
cttctagttctggacaccttttaggg--nnnnnnnctctagctttttagttgaagacatttctatcataaacct----taggaattggattagaaacatg |
247 |
Q |
| |
|
|||||| |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
38414825 |
cttctaattctagacaccttttagggtttttttttctctagctttttagttgaagacatttctatcataaaccttatataggaattggattggaaacatg |
38414924 |
T |
 |
| Q |
248 |
ttccatccaataagaaaagagagaagattcgaggaattctttctt |
292 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38414925 |
ttccatccaataagaaa--agagaagattcgaggaattctttctt |
38414967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 306 - 338
Target Start/End: Original strand, 38414983 - 38415015
Alignment:
| Q |
306 |
gattcgagggattctaaatcgaaagaaatgcta |
338 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
38414983 |
gattcgaggaattctaaatcgaaagaaatgcta |
38415015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University