View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16470_low_9 (Length: 250)
Name: NF16470_low_9
Description: NF16470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16470_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 38415205 - 38414983
Alignment:
| Q |
18 |
ccttaaagaggtaaggactaaattcttgatatcaaatgagactggatacacagattggaacccaaaagacacgtcctct-aagttgtcaaacttttcata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38415205 |
ccttaaagaggtaaggactaaattcttgatatcaaatgagactggatacacatgttggaacccaaaagacacgtcctcttaagttgtcaaacttttcata |
38415106 |
T |
|
| Q |
117 |
atcatgcatggaatgtctcgcatctctaggatgaaaactgctcttgttgcttcttcattctttttggctaaccagattttcatatgaccctagcatttct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38415105 |
atcatgcatggaatgtctcgcatctctaggatgacaactgctcttgttgcttcttcattctttttggctaaccagattttcatatgaccctagcatttct |
38415006 |
T |
|
| Q |
217 |
ttcgatttagaattcctcgaatc |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38415005 |
ttcgatttagaattcctcgaatc |
38414983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University