View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16471_high_24 (Length: 387)
Name: NF16471_high_24
Description: NF16471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16471_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 9e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 266 - 373
Target Start/End: Complemental strand, 46513231 - 46513124
Alignment:
| Q |
266 |
aaattatctcaactgagttgatcgcagacacgaacaagccaacacatagcttaatagaattttaaatatcaattgattgtttgtccagattgcaatgagt |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46513231 |
aaattatctcaactgagttgatcgcagacacgaacaagctaacacatagcttaatagaattttaaatatcaattgattgtttgtccagattgcaatgagt |
46513132 |
T |
 |
| Q |
366 |
tgctttgt |
373 |
Q |
| |
|
|||||||| |
|
|
| T |
46513131 |
tgctttgt |
46513124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 87 - 155
Target Start/End: Original strand, 5157654 - 5157726
Alignment:
| Q |
87 |
ctacaatctaacttcatgagctgtatct-atgtacctcacattttc---ttgtataaacatatctgagctcac |
155 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||| |||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
5157654 |
ctacaatccaacttcatgagctgtatctaatgtccctcgcattttcctatattataaacatatctgagctcac |
5157726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University