View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16471_high_43 (Length: 215)
Name: NF16471_high_43
Description: NF16471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16471_high_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 26375565 - 26375746
Alignment:
| Q |
18 |
aattaaattcttaataagatgcttttaattttaagcggtttgtctacatccttgtggtattgattgtaaatttaccaagttatatagaggaataaactca |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26375565 |
aattaaattcttaataagatacttttaattttaagcggtttgtctacatccttgtggtattgattgtaaatttaccaagttatatagaggaataaactca |
26375664 |
T |
|
| Q |
118 |
gttgtaaatatcaccaaatgacaattgcatgcaaccactttacaatctttttggcttgtatgccatgaatgaatatgaccta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26375665 |
gttgtaaatatcaccaaatgacaattgcatgcaaccactttacaatctttttggcttgtatgccatgaatgaatatgaccta |
26375746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 199
Target Start/End: Original strand, 26375753 - 26375796
Alignment:
| Q |
156 |
tttacaatctttttggcttgtatgccatgaatgaatatgaccta |
199 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26375753 |
tttaaaatctttctggcttgtatgccatgaatgaatatgaccta |
26375796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University