View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16471_low_41 (Length: 236)
Name: NF16471_low_41
Description: NF16471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16471_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 24 - 199
Target Start/End: Complemental strand, 49623031 - 49622856
Alignment:
| Q |
24 |
ggattacgtttaatagcaacatttattggtcaaaagtaaccacaacttcattagtgtctgctactacactccattatatagcttttaacaagattctcta |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49623031 |
ggattacgtttaatagcaacatttattggtcaaaagtaaccacaacttcattagtgtctgctactacactccattatatagcttttaacaagattctcta |
49622932 |
T |
 |
| Q |
124 |
aattcactttagtctaagctttatgttacttcatatgctttgttcaatcatgtgctttagtaccctcctatgctac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49622931 |
aattcactttagtctaagctttatgttacttcatatgctttgttcaatcatgtgctttagtaccctcctgtgctac |
49622856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University