View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16471_low_43 (Length: 226)
Name: NF16471_low_43
Description: NF16471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16471_low_43 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 33266755 - 33266527
Alignment:
| Q |
7 |
tttgtggataaaattgggaaagaatgggttttccttactgttgctgaagctgtggaagcatgcctatcttataaattcgctgatccatgatttcatgggt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33266755 |
tttgtggataaaattgggaaagaatgggttttccttactgttgctgaagctgtggaagcatgcctatcttataaatttgctgatccatgatttcatgggt |
33266656 |
T |
 |
| Q |
107 |
c-------cccnnnnnnnnnnnatatctatagtgtaatttttacggtacaattttaggcactaagagttgtgtat--tatgtttggagagtttcttttgt |
197 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
33266655 |
ctttttttttttttttttttttatatctatagtgtaatttttacggtacaattttaggcgctaagagttgtgtattatatgttttgagagtttcttttgt |
33266556 |
T |
 |
| Q |
198 |
catcctgtaaacttcacgtgtgacctatt |
226 |
Q |
| |
|
|||| |||||||||||||||||||||||| |
|
|
| T |
33266555 |
catcttgtaaacttcacgtgtgacctatt |
33266527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University