View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16471_low_44 (Length: 223)
Name: NF16471_low_44
Description: NF16471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16471_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 23 - 207
Target Start/End: Complemental strand, 32974139 - 32973955
Alignment:
| Q |
23 |
atgccctttaggtagggagatgagttcttatgggttgttcctcttcgtctctaatttattcatttgttacattttttcatctcttatcttgcacaacttc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32974139 |
atgccctttaggtagggagatgagttcttatgggttgttcctcttcgtctctaatttattcattagttacattttttcatctcttatcttgcacaacttc |
32974040 |
T |
 |
| Q |
123 |
ttcaaatttcattggttcgaaatctgcagaggcataacaatgtgatattatcaatttccattgttttcttcataaagatcttcat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32974039 |
ttcaaatttcattggttcgaaatctgcagaggcataacaatgtgatattatcaatttccattgttttcttcataaagatcttcat |
32973955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University