View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16472_low_3 (Length: 294)
Name: NF16472_low_3
Description: NF16472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16472_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 215
Target Start/End: Complemental strand, 32874707 - 32874508
Alignment:
| Q |
16 |
tcattatactcatatgattgattaaacataattgaccatgtttgtggctagtgtcagttgaagaaccaaaacaacttctagcagaaagttgagctagcag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874707 |
tcattatactcatatgattgattaaacataattgaccatgtttgtggctagtgtcagttgaagaaccaaaacaacttctagcagaaagttgagctagcag |
32874608 |
T |
 |
| Q |
116 |
tgtctgaaatcacaagaaattttgagcgtttctgggagaaccacgtaatatctaccagatagtggtgccaagaaatttgtaaaatggaggcaacctacac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32874607 |
tgtctgaaatcacaagaaattttgagcgtttctgggagaacgacgtaatatctaccagatagtggtgtcaagaaatttgtaaaatggaggcaacctacac |
32874508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 245 - 285
Target Start/End: Complemental strand, 32874478 - 32874438
Alignment:
| Q |
245 |
tattttactttattattgtatatgattgaacctattcatct |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874478 |
tattttactttattattgtatatgattgaacctattcatct |
32874438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University