View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16473_high_11 (Length: 240)
Name: NF16473_high_11
Description: NF16473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16473_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 2525178 - 2525386
Alignment:
| Q |
1 |
taataattgaattatagtttattctattccattttatagctcatatgcaaataagaaaagcaaagatatgaaatttatttatcttatgttatactgatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2525178 |
taataattgaattatagtttattctattccattttatagctcatatgcaaataagaaaagcaaggatatgaaatttatttatcttatgttatactgatat |
2525277 |
T |
|
| Q |
101 |
gatatttatcttatttttagataagcactatgatattattacgatttaattatatttgagaaattatatttgagaaactcatgaaaaatgtgtgaattaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2525278 |
gatatttatcttatttttagataagcactatgatattattatgattt--------------aattatattttagaaactcatgaaaaatgtgtgaattaa |
2525363 |
T |
|
| Q |
201 |
tcagcatcggcagccttggtaaa |
223 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
2525364 |
tcagcattggcagccttggtaaa |
2525386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University