View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16473_low_11 (Length: 251)
Name: NF16473_low_11
Description: NF16473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16473_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 2122771 - 2122995
Alignment:
| Q |
19 |
tataggactctatgacactcat---ttgtaactcaaatctgaattacaactaatttacaaccaatgaggcagggacatctctagcattagccgtgtcgca |
115 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2122771 |
tataggactctatgacactcatcatttgtaactcaaatctgaattacaactaatttacaaccaatgaggcagggacatctctagcattagccgtgtcgcg |
2122870 |
T |
 |
| Q |
116 |
gtgtccggcacacatcggtgtctgatactcacaccgatgtcctaaaatagnnnnnnnnnnnnnnnnnngctttgacacttctttcgagttctttgctaat |
215 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2122871 |
gtgtccagcacacatcggtgtctgatactcataccgatgtcctaaaatagtttttattttttatttttgctttgacacttctttcgagttctttgctaat |
2122970 |
T |
 |
| Q |
216 |
gctcacaaccaaatcatcccttcat |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2122971 |
gctcacaaccaaatcatcccttcat |
2122995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University