View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16474_low_11 (Length: 254)
Name: NF16474_low_11
Description: NF16474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16474_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 31671241 - 31671195
Alignment:
| Q |
1 |
agaaagaactaacatagggaaagtgagtcgagactttgatgtgaaaa |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31671241 |
agaaagaactaacatagggaaagtgagtcgagactttgatgtgaaaa |
31671195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 212 - 254
Target Start/End: Complemental strand, 31670988 - 31670946
Alignment:
| Q |
212 |
ctcacaagatatcaacactatagaaacaaaaaatatttctaaa |
254 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31670988 |
ctcacaagatatcaacactgtagaaacaaaaaatatttctaaa |
31670946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University