View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16474_low_12 (Length: 240)
Name: NF16474_low_12
Description: NF16474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16474_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 22794986 - 22795210
Alignment:
| Q |
1 |
cccatcactgagacccctgaaaataaaatcaactcgcgtcgccgttctttcatggggtatgtatgcatttttacttccaactactcgtctttttagtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
22794986 |
cccatcactgagacccctgaaaataaaatcaactcgcgtcgccgttctttcatggggtatgtatgcatttttacttacaactactcatctttttagtttg |
22795085 |
T |
 |
| Q |
101 |
aaaaa--atatgtgttttctttttgctcgtattcaatgtcatgagcaatttgta--tacatgcttctgcaggttcataaggaaaagtttgtcaaacaatg |
196 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||| | | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22795086 |
aaaaaatatatgtgttttctttttgctcgtattcaatgtcatgagcattttgtatgtgttttcttctgcaggttcataaggaaaagtttgtcaaacaatg |
22795185 |
T |
 |
| Q |
197 |
aaagcttcaatgatgaacagcttgc |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
22795186 |
aaagcttcaatgatgaacagcttgc |
22795210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University