View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16475_high_5 (Length: 275)
Name: NF16475_high_5
Description: NF16475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16475_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 5 - 108
Target Start/End: Complemental strand, 32267273 - 32267170
Alignment:
| Q |
5 |
gagaagcataggaagtttgtatgcaaatattgcttcaagaggtttccttgtgggaagtctcttggtggtcacatcagaacacacatgacagaagaaagaa |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267273 |
gagaaacataggaagtttgtatgcaaatattgcttcaagaggtttccttgtgggaagtctcttggtggtcacatcagaacacacatgacagaagaaagaa |
32267174 |
T |
 |
| Q |
105 |
ataa |
108 |
Q |
| |
|
|||| |
|
|
| T |
32267173 |
ataa |
32267170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 181 - 237
Target Start/End: Complemental strand, 32267100 - 32267044
Alignment:
| Q |
181 |
aaacctcatttatggtctaagagaaaatcccaagaaaacaatgaggtttgtgcattc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267100 |
aaacctcatttatggtctaagagaaaatcccaagaaaacaatgaggtttgtgcattc |
32267044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 19301560 - 19301508
Alignment:
| Q |
182 |
aacctcatttatggtctaagagaaaatcccaagaaaacaatgaggtttgtgca |
234 |
Q |
| |
|
||||| ||||||||||| ||||| |||||||||||||||| ||||||||||| |
|
|
| T |
19301560 |
aaccttatttatggtcttagagagaatcccaagaaaacaactaggtttgtgca |
19301508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University