View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16475_low_10 (Length: 237)
Name: NF16475_low_10
Description: NF16475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16475_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 29608145 - 29607942
Alignment:
| Q |
1 |
cactacataacaaggattgaaccaaatcaaaacaactcatccttcatatttgttggtgtcagacacgtacacatgtcagccactggacacgtcttggatc |
100 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
29608145 |
cactacatatcaatgattgaaccaaatcaaaacaactcatccttcatatttgttggtgtcag-----------------ccactggacacgtcttcgatc |
29608063 |
T |
 |
| Q |
101 |
agaagtgtcagtggtactggtactgaacatagaactattagattctagatttttatgctccctttaaattgcaattgcagctacacgattgtgggttgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29608062 |
agaagtgtcagtggtactggtactgaacatagaactattagattctagatttttatgctccctttaaattgcaattgcagctacacgattgtgggttgtg |
29607963 |
T |
 |
| Q |
201 |
agcttaaaatcatgtcaatgg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29607962 |
agcttaaaatcatgtcaatgg |
29607942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 113
Target Start/End: Original strand, 28136270 - 28136314
Alignment:
| Q |
69 |
acacatgtcagccactggacacgtcttggatcagaagtgtcagtg |
113 |
Q |
| |
|
||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
28136270 |
acacatgtcagacaccagacacgtcttcgatcagaagtgtcagtg |
28136314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University