View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16477_high_13 (Length: 246)
Name: NF16477_high_13
Description: NF16477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16477_high_13 |
 |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0014 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 83627 - 83398
Alignment:
| Q |
1 |
tttctcaaatcacaaaaacatacatatataagcatcacaaggtaagttcactcatggcaattacatatatgcacaagaaccaaattttaaaattagaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
83627 |
tttctcaaatcacaaaaacatacatatataagcatcacaaggtaagttcactcatggcaattacatatatgcacaagaaccaaattttaaaattagaaaa |
83528 |
T |
 |
| Q |
101 |
atcactatgaaagtgtaaaagagaccacataaatgactgtagtgtgcagaaaaatatttcaaccttgttcacataaccctgtatatcacaaaaccacata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
83527 |
atcactatgaaagtgtaaaagagaccacataaatgactgtagtatgcagaaaaatatttcaaccttgttcacataagcctgtatatcacaaaaccacaca |
83428 |
T |
 |
| Q |
201 |
tgcatatgttttaatggcttaagaatatgt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
83427 |
tgcatatgttttaatggcttaagaatatgt |
83398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University