View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16477_low_11 (Length: 265)
Name: NF16477_low_11
Description: NF16477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16477_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 5900627 - 5900849
Alignment:
| Q |
7 |
aaagaatcttacaagtacaatgtttagcatctttnnnnnnnnngtataaagtttaaccaatgaacgacttcattagtctaaattttctttcctttnnnnn |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
5900627 |
aaagaatcttacaagtacaatgtttagcatctttaaaaaaaaagtataaagtttaaccaatgaacgacttcaataatctaaattttctttcctttaaaaa |
5900726 |
T |
 |
| Q |
107 |
nntgatttaaagactctttcgaagacatgttgataaaataaaactgtgcttctaatatgtactaatggacctcnnnnnnngagttcaattgtggactctc |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
5900727 |
aatgatttaaagactctttcgaggacatgttgatcaaataaaattgtgcttctaatatgaactaatggacctcaaaaaaagagttcaattgtggactctc |
5900826 |
T |
 |
| Q |
207 |
acagtttttagtaaaacacccca |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5900827 |
acagtttttagtaaaacacccca |
5900849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University