View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16477_low_7 (Length: 305)
Name: NF16477_low_7
Description: NF16477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16477_low_7 |
 | |
|
| [»] scaffold0014 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0014 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 83601 - 83801
Alignment:
| Q |
1 |
atatgtatgtgtttgtgatttgagaaaattataaaagctgtacataatttatataaggaaatgtaatattgagaaacttttcaataagtttgaatagttt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
83601 |
atatgtatgtttttgtgatttgagaaaattataaaagcaatacataatttatatgaggaaatgtaatattgagaaacttttcaataagtttgaatagttt |
83700 |
T |
|
| Q |
101 |
aaagttaaactgttcagcattccatacaattatatgatgatacttgattgaagaaaattgataggaataatttgttggccaaagttgaacccatgactaa |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
83701 |
aaagttaaactgttcaggattccatacaattatatgatgatacttgattgaagaaaattgacaggcataatttgttcgccaaagttgaacccatgactaa |
83800 |
T |
|
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
83801 |
t |
83801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 214 - 297
Target Start/End: Original strand, 83858 - 83941
Alignment:
| Q |
214 |
ttatcataaattatttaaagtttgtttgatagtgtggtcatgagaatgaatttattataagtatcttagttctttgcctttgct |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
83858 |
ttatcataaattatttaaagtttgtttgatagtgtggtcatgagaatgaatttattataagtattttagttctttacctttgct |
83941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University