View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16478_low_14 (Length: 263)
Name: NF16478_low_14
Description: NF16478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16478_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 10 - 147
Target Start/End: Original strand, 864899 - 865036
Alignment:
| Q |
10 |
aaaggcaaaggtgtcattgatggtcaaggatctgtttggtggaatgatagtgagaaactaccaaaaaccaaaccaacggtaagaataatcatttcattga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||| |
|
|
| T |
864899 |
aaaggcaaaggtgtcattgatggtcaaggctctgtttggtggaatgatagtgagaaactaccaaaaaccaaaccaacggtaagaatagtcctagcattgg |
864998 |
T |
 |
| Q |
110 |
acttctttatcattaaaatatgatttaatttatatgca |
147 |
Q |
| |
|
| |||| | |||||||||||||||| | |||||||||| |
|
|
| T |
864999 |
atttctatgtcattaaaatatgattcattttatatgca |
865036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University