View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16478_low_17 (Length: 237)
Name: NF16478_low_17
Description: NF16478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16478_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 92 - 221
Target Start/End: Original strand, 865376 - 865505
Alignment:
| Q |
92 |
ttttaaattgaccttgcatcaaaattaatctcttaaaactataagattctctcatttgtgattttgacatttttgttatatgtaggcactaaggttctat |
191 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
865376 |
ttttaaattgactttgcgtcaaaattaatctcataaaactataagattctatcatatgtgattttgacatttttgttatatgtaggcactaaggttctat |
865475 |
T |
 |
| Q |
192 |
ggaagtgatggtgtaagtgtgagtggtata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
865476 |
ggaagtgatggtgtaagtgtgagtggtata |
865505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 124
Target Start/End: Original strand, 36655261 - 36655340
Alignment:
| Q |
43 |
taaaagtcatacaaatgattatatacaattgattgagtgagtgtaaattttttaaattgaccttgcatcaaaattaatctct |
124 |
Q |
| |
|
||||||||||||||||||| || || ||||| ||| ||||| ||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
36655261 |
taaaagtcatacaaatgatgatttataattggctgac--agtgtcaattttttacattgacactgcatcaaaattaatctct |
36655340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University