View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16479_high_2 (Length: 361)
Name: NF16479_high_2
Description: NF16479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16479_high_2 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 12 - 361
Target Start/End: Complemental strand, 19781074 - 19780725
Alignment:
| Q |
12 |
cagagacaggtttctatgctggtggttcagatgggtttgtttataaagggttaatgaaagttgggaatagaaaaatgttggaaaaaggaaaagcttatga |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
19781074 |
cagagtcaggtttctatgctggtggttcagatgggtttgtttataaagggttaatgaaagttgggaatagaaaaatgttagaaaaaggaaaagcgtatga |
19780975 |
T |
 |
| Q |
112 |
attggttaatttgggtaacaaaacaaaaagccatgatgggtcaattatgtctttggttttggtgaatgaagggaggaatttggtgtctgcttcagaagat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19780974 |
attggttaatttgggtaacaaaacaaaaagccatgatgggtcaattatgtctttggttttggtgaatgaagggaggaatttggtgtctgcttcagaagat |
19780875 |
T |
 |
| Q |
212 |
gggagtgtttggatgtgggatgttgagaaaggtgaagtcattatggttttggggaatgatcaaatattaggaagaagatcaacaagaagcattggtgata |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19780874 |
gggagtgtttggatgtgggatgttgagaaaggtgaagtcattatggttttggggaatgatcaaatattaggaagaagatcaacaagaagcattggtgata |
19780775 |
T |
 |
| Q |
312 |
tgatagtggtcaaagggagtaatgttacaaagggaaatgctagtagtaaa |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19780774 |
tgatagtggtcaaagggagtaatgttacaaagggaaatgctagtagtaaa |
19780725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University