View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16480_high_18 (Length: 248)
Name: NF16480_high_18
Description: NF16480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16480_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 32400322 - 32400082
Alignment:
| Q |
1 |
cttctaggaattttccatttctttcattgtatggtgactttgccttacactaccgattcaatgctttccgcgacggggcggttgtggtga-------tgg |
93 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32400322 |
cttctaggaattttccttttctttcattgtatggtgactttgccttacactaccgattcaatgctttccgcgacggggcggttgtggtgaatggtgatgg |
32400223 |
T |
 |
| Q |
94 |
gtcgctggacatggtg---acaacacacacaagaggacgctgatgggtgctgggccacaagttttgatggtggttcagaaacttcaatcaccataagttt |
190 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32400222 |
gtcgctggaaatggtggtgacaacacacacaagaggacgctgatgggtgctgggccacaagttttgatggtggttcagaaacttcaatcaccataagttt |
32400123 |
T |
 |
| Q |
191 |
tgtgtaaacacaatcttcacactcacaagttgtgttaaatc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32400122 |
tgtgtaaacacaatcttcacactcacaagttgtgttaaatc |
32400082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 29308409 - 29308361
Alignment:
| Q |
164 |
ttcagaaacttcaatcaccataagttttgtgtaa-acacaatcttcaca |
211 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||| |||||||||| |
|
|
| T |
29308409 |
ttcagaaacttcaatcaccacaagttttgtgtaacacaaaatcttcaca |
29308361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University