View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16480_high_19 (Length: 243)
Name: NF16480_high_19
Description: NF16480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16480_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 12 - 222
Target Start/End: Original strand, 38820516 - 38820718
Alignment:
| Q |
12 |
aagaatatcatctagtttgtgcatgtagattactaggacgctctcctagtactcagtttcatccatcaattattgagtgagcgagagaaatcaatgtttg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38820516 |
aagaatatcatctagtttgtgcatgtagatt--------gctctcctagtactcagtttcatccatcaattattgagtgagcgagagaaatcaatgtttg |
38820607 |
T |
 |
| Q |
112 |
tttccataatttatgagaaaaacttgtagctcttggcttgaacgatgatattcctcatagcaccaattggggatagtgtcattatcatgacaccaataac |
211 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38820608 |
tttccataatttatgagaagaacttgtagctcttggcttgaacgatgatattcctcatagcaccaattggggatagtgtcattatcatgacaccaataac |
38820707 |
T |
 |
| Q |
212 |
aatgcatatct |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
38820708 |
aatgcatatct |
38820718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University