View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16480_high_25 (Length: 225)
Name: NF16480_high_25
Description: NF16480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16480_high_25 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 46 - 225
Target Start/End: Original strand, 49235209 - 49235388
Alignment:
| Q |
46 |
acatgtacaagttactttctggtggcaaatgcaatagcatgcacacacggagccatctctatgctacttaccttgctaaatagaggaaaaagcaaagtgt |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49235209 |
acatgtacaagttactttctggtggcaaatgcaatagcatgcacatacggagccatctctatgctacttaccttgctaaatagaggaaaaagcaaagtgt |
49235308 |
T |
 |
| Q |
146 |
tttggggaacattgatcactatctttgacgcattgatggtggctttgctattttccgccaacggtgccgccaccgcaatt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49235309 |
tttggggaacattgatcactatctttgacgcattgatggtggctttgctattttccggcaacggtgccgccaccgcaatt |
49235388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University