View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16480_high_7 (Length: 454)
Name: NF16480_high_7
Description: NF16480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16480_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 315; Significance: 1e-177; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 18 - 336
Target Start/End: Original strand, 7897688 - 7898006
Alignment:
| Q |
18 |
attaggggtacgaggtgttgtggcagcagaagaagaaggagaaacaggttcagaaacagtgttcctaataatcataatgctacgagtaacaacaggaaca |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7897688 |
attaggggtacgaggtgttgtagcagcagaagaagaaggagaaacaggttcagaaacagtgttcctaataatcataatgctacgagtaacaacaggaaca |
7897787 |
T |
 |
| Q |
118 |
tcatgatccttcaccggcggcaaccgtacgccggagctagcagcagaaaaagagttgtacttccgaagcttacccaaacctgtttcaggtgtgggacccg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7897788 |
tcatgatccttcaccggcggcaaccgtacgccggagctagcagcagaaaaagagttgtacttccgaagcttacccaaacctgtttcaggtgtgggacccg |
7897887 |
T |
 |
| Q |
218 |
ccaacgtttcgtcccaaagtttctcaagaaatcccataataatgatgtctcaaattaacacaaattaaaaggtttaaagatgaaggaagggacgaaacga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7897888 |
ccaacgtttcgtcccaaagtttctcaagaaatcccataataatgatgtctcaaattaacacaaattaaaaggtttaaagatgaaggaagggacgaaacga |
7897987 |
T |
 |
| Q |
318 |
tttgaaagaattttattac |
336 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7897988 |
tttgaaagaattttattac |
7898006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 380 - 449
Target Start/End: Original strand, 7898050 - 7898119
Alignment:
| Q |
380 |
gtggggtgtgatggtacttataaggattaggatgaagagttgataaggttaattgaattattagtattat |
449 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7898050 |
gtggggtgtgatggtacttataaggattaggatgaagagttgataaggttaattgaattattagtattat |
7898119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University