View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16480_low_13 (Length: 359)
Name: NF16480_low_13
Description: NF16480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16480_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 350
Target Start/End: Complemental strand, 38820538 - 38820187
Alignment:
| Q |
1 |
tgcacaaactagatgatattcttaggggatctctaatggtaatgcatgtgcaaccta-----gccttaagttatatctaataatgtacttattatagtga |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38820538 |
tgcacaaactagatgatattcttaggggatctctaatggtaatgcatgtgcaacctaacctagccttaagttatatctaataatgtgcttattatagtga |
38820439 |
T |
 |
| Q |
96 |
cgcgatttcaatttacacggttgcaaaaattatcatactctacaccacgagtgttattgtgggtgtgtgtgatatatttgcttgagcagacacttgaatt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38820438 |
cgcgatttcaatttacacggttgcaaaaattatcatactctacac---gagtgttattgtgggtgggtgtgatatatttgcttgagcagacacttgaatt |
38820342 |
T |
 |
| Q |
196 |
gtaacacaatttatgtcgtgtatattgtttgtttggtggtcgatgttgttgaataactaaaatattgctgtacattattaattcaatatggaatatgctt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38820341 |
gtaacacaatttatgtcgtgtatattgtttgtttggtggtcgatgttgttgaataactaaaatattgctgtacattattaattcaatatggaatatgttt |
38820242 |
T |
 |
| Q |
296 |
tatatattttgcacacacatcctttcctttcctttatttatcaaagaagaataat |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38820241 |
tatatattttgcacacacatcctttcctttcctttatttatcaaagaagaataat |
38820187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University