View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16481_low_19 (Length: 286)
Name: NF16481_low_19
Description: NF16481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16481_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 2352329 - 2352047
Alignment:
| Q |
1 |
ctacaatatcatatcgtatgctacaccatttaaaatatgtcacatcgttttttagtccaaaaacaagagaaaggaaccaaaattgaggaccaattttgtg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2352329 |
ctacaatatcatatcatatgctacaccatttaaaatatgtcacatcattttttagtccaaaaacaagagaaaggaaccaaaattgaggaccaattttgtg |
2352230 |
T |
|
| Q |
101 |
agtgagggaaaatagagggaccaaaaatgtaattaa--nnnnnnnnnnatcaaccctccggttcttgagggaaaacgggggaatggaaaatgtaattaag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2352229 |
agtgagggaaaatagagggaccaaaaatgtaattaaacttttttttttatcaaccctccggttcttgagggaaaacgggggaatggaaaatgtaattaag |
2352130 |
T |
|
| Q |
199 |
cc-cnnnnnnnnnnactaaccctcaggttctattaattgactatcacaggtaagtaaatggaacatggattaatcgacataaa |
280 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2352129 |
ccttttttttttttactaaccctcaggttctattaattgactatcacaggtaagtaaatggaacatggattaattgacataaa |
2352047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University