View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16481_low_21 (Length: 240)
Name: NF16481_low_21
Description: NF16481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16481_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 228
Target Start/End: Original strand, 39793993 - 39794201
Alignment:
| Q |
20 |
agcgtgtaacaaacaattaacccgagttgattttacgaaatgactgagtgatgtcgtcctgaaacatccctctgtctatccggctaaactccaatcatac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39793993 |
agcgtgtaacaaacaattaacccgagttgattttacgaaatgactgagtgatgtcgtcctgaaacatccctctgtctatccggctaaactccaatcatac |
39794092 |
T |
 |
| Q |
120 |
caggctagagccggaactctcttgtcgtcatgaaggttttccttttggaaaaaatcatatcccaaataatctgatgcttcctaggccacgacttatctga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39794093 |
caggctagagccggaactctcttgtcgtcatgaaggttttccttttggaaaaaatcatatcccaaataatctgatgcttcctaggccacgacttatctga |
39794192 |
T |
 |
| Q |
220 |
atataccta |
228 |
Q |
| |
|
||||||||| |
|
|
| T |
39794193 |
atataccta |
39794201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 82 - 171
Target Start/End: Original strand, 2934925 - 2935017
Alignment:
| Q |
82 |
aacatccctctgtctatccggctaaactccaat---cataccaggctagagccggaactctcttgtcgtcatgaaggttttccttttggaaaa |
171 |
Q |
| |
|
|||||||||||| |||||||| |||||||| || |||| ||||||||| |||| ||||| |||||||||| ||||||||||| ||||| |
|
|
| T |
2934925 |
aacatccctctggctatccggataaactcctatgatcatattaggctagagtcggactcctcttatcgtcatgaaagttttccttttagaaaa |
2935017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University