View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16481_low_22 (Length: 233)
Name: NF16481_low_22
Description: NF16481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16481_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 2 - 215
Target Start/End: Complemental strand, 26616905 - 26616692
Alignment:
| Q |
2 |
tcaatggaaatggcaatcacaactcagagccgaatccgcaaagaacttaccaagtagtagtaattgcaacccgagatatgggtattgctaaggatggaaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26616905 |
tcaatggaaatggcaatcacaactcagagccgaatccgcagaggacttaccaagtagtagtaattgcaacccgagatatgggtattgctaaggatggaaa |
26616806 |
T |
|
| Q |
102 |
attaccctggacattgcctattgatcaaaagttttttgaggatatcacaacagtgacatctgatcctgggaagaagaatgccgttgtcatgggtagaaaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26616805 |
attaccctggacattgcctattgatcaaaagttttttgaggatatcacaacagtgacatctgatcctgggaagaagaatgccgttgtcatgggtagaaaa |
26616706 |
T |
|
| Q |
202 |
tcatgggaggctat |
215 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26616705 |
tcatgggaggctat |
26616692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University