View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16481_low_24 (Length: 208)
Name: NF16481_low_24
Description: NF16481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16481_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 13 - 92
Target Start/End: Complemental strand, 37305974 - 37305895
Alignment:
| Q |
13 |
attattctcattgaaacaccgctaaagctgacagaagaatctaacaaagaattcatcatctgaaagccatttaaggatct |
92 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37305974 |
attaatctcattgaaacaccgctaaagctgacagaagaatctaacaaagaattcatcatctgaaagccatttaaggatct |
37305895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 123 - 189
Target Start/End: Complemental strand, 37305864 - 37305800
Alignment:
| Q |
123 |
gattttctagttgaagcttttttgattgtgaaatatgcaagctggtttaatgattccagctagtaac |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37305864 |
gattttctagttgaagcttttttgattg--aaatatgcaagctggtttaatgattccagctagtaac |
37305800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University