View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16482_high_10 (Length: 256)
Name: NF16482_high_10
Description: NF16482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16482_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 29519761 - 29519534
Alignment:
| Q |
19 |
agagctttcaatcaagagagatttatttgattgttctcttcagaatcaaaatggtgggtattttctcgttggttacgggcatggctggaccaagtggatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29519761 |
agagctttcaatcaagagagatttatttgattattctcttcagaatcaaaatggtgggtattttctcgttggttacgggcatggctggaccaagtggatt |
29519662 |
T |
|
| Q |
119 |
tggatcctctacaacagctgaacaagttactcaaggaattgatgcaagcaacctcactgcaattatcacagg--nnnnnnnnaattcaccttgtttgttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
29519661 |
tggatcctctacaacagctgaacaagttactcaaggaattgatgcaagcaacctcactgcaattatcacaggttttttttttaattcacc----ttgttt |
29519566 |
T |
|
| Q |
217 |
gaacatgaaaatgatgtgatatatttcatttc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29519565 |
gaacatgaaaatgatgtgatatatttcatttc |
29519534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 99 - 190
Target Start/End: Original strand, 40098961 - 40099052
Alignment:
| Q |
99 |
atggctggaccaagtggatttggatcctctacaacagctgaacaagttactcaaggaattgatgcaagcaacctcactgcaattatcacagg |
190 |
Q |
| |
|
|||||||| |||||||| |||||||| || |||| || || || |||||||||||||||||||| |||||||| || |||||||||||||| |
|
|
| T |
40098961 |
atggctggtccaagtgggtttggatcagcttcaactgcagagcaggttactcaaggaattgatgctagcaaccttaccgcaattatcacagg |
40099052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University