View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16482_high_5 (Length: 343)
Name: NF16482_high_5
Description: NF16482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16482_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 46 - 332
Target Start/End: Original strand, 2486085 - 2486371
Alignment:
| Q |
46 |
ggtaattaagagtcgagtactgcaacatggtgacaggattatgccatggtttggcgtctgcgaggctcacaaacgattgaatattgccaactagagcact |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2486085 |
ggtaattaagagtcgagtactgcaacatggtgacaggattatgccatggtttggcgtctgcgaggctcacaaacgattgaatattgccaacgagagcact |
2486184 |
T |
|
| Q |
146 |
gcttgaaagggcccataattaaatttatttattattagtcatttagttgtgattatgaatgatgatgttaaagtggagtgaatgtcatgtaactcaactg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2486185 |
gcttgaaagggcccataattaaatttatttattattagtcatttagttgtgattatgaatgatgatgttatagtggagtgaatgtcatgtaactcaactg |
2486284 |
T |
|
| Q |
246 |
gggggagaggaattgtttctgttctattgcaaattgtgaacattgtcttttatttagattattgataatttttgtgccactgtctgt |
332 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2486285 |
gggggagatgaattgtttctgttctattgcaaattgtgaacattgtcttttatttagattattggtaatttttgtgccactgtctgt |
2486371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 76
Target Start/End: Complemental strand, 768851 - 768818
Alignment:
| Q |
43 |
tatggtaattaagagtcgagtactgcaacatggt |
76 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
768851 |
tatggtaattaagagtcgagtacagcaacatggt |
768818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University