View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16482_low_6 (Length: 341)
Name: NF16482_low_6
Description: NF16482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16482_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 1 - 333
Target Start/End: Complemental strand, 32548872 - 32548540
Alignment:
| Q |
1 |
ccaactcttactttaatttgtgctgaaatcaaccctgtagtactaatgctaggttcttaaaatgtacccaagaaagtgaaatggttttgaaatactagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32548872 |
ccaactcttactttaatttgtgctgaaatcaaccctgtagtactaatgctaggttcttaaaatgtacccaagaaagtgaaatggttttgaaatactagaa |
32548773 |
T |
 |
| Q |
101 |
agtcttgcaatggtttcagtccttcagttcaatcatcttttcactaccattgtagtcagcaaattgatttttgaattgcaattgcgtgacacctaatgtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32548772 |
agtcttgcaatggtttcagtccttcagttcaatcatcttttcactaccattgtagtcagcaaattgaattttgaattgcaattgcgtgacacctaatgtc |
32548673 |
T |
 |
| Q |
201 |
attaaaaatttatgcccttatcgatgggtctatttgtgattctcttggtttaaatcaaagtggttgtgcagtaatttttggtgatgatatattgatattc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32548672 |
attaaaaatttatgcccttatcgatgggtctatttgtgattctcttggtttaaatcaaagtggttgtgcagtaatttttggtgatgatatattgatattc |
32548573 |
T |
 |
| Q |
301 |
agcatttcctgatgccaacaatttatctctgct |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32548572 |
agcatttcctgatgccaacaatttatctctgct |
32548540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University