View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16483_low_5 (Length: 365)
Name: NF16483_low_5
Description: NF16483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16483_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 11 - 354
Target Start/End: Original strand, 3343823 - 3344166
Alignment:
| Q |
11 |
gaagcataggtgtgtctctatcattgtgtgtctatttccattctaaggaaatgggcaaatcactcgtgagactgctcatcgacgggttggaagaagaaga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
3343823 |
gaagcataggtgtgtctctatcattgtgtgtctatttccattctaaggaaatgggcaaatcactcatgagactgctcatcgacgagttggaagaagaaga |
3343922 |
T |
 |
| Q |
111 |
gggaaaccttgaactacaatttatggggttctattgtttatgcttatgcagtgatttttggggatgatttaannnnnnnnnnnnnnagggatttgattta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3343923 |
gggaaaccttgaactacaatttatggggttctattgtttatgtttatgcagtgatttttggggatgatttaattttttttctttttagggatttgatttg |
3344022 |
T |
 |
| Q |
211 |
catgcagaatgcataattacagtttctggggttctattgttcttgccttttggccnnnnnnnatacgacaatttggtagnnnnnnntatgctaaaagctt |
310 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
3344023 |
catgcagaatgcataattatagtttctggggttctattgttcttgccttttggcctttttttatacgacaatttggtagaaaaaaatatgctaaaagctt |
3344122 |
T |
 |
| Q |
311 |
cagacaacagcagaaacttcaatggtgtagtggatgatgatgat |
354 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
3344123 |
cagacaacagcagaatcttcaatggtgtagtggatgaagatgat |
3344166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 111; Significance: 6e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 11 - 263
Target Start/End: Original strand, 47527502 - 47527758
Alignment:
| Q |
11 |
gaagcataggtgtgtctctatcattgtgtgtctatttccattctaaggaaatgggcaaatcactcgtgagactgctcatcgacgggttggaagaagaaga |
110 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47527502 |
gaagcataggcgtgtctctttcattgtgtgtctatttccattctaaggaaatgggcaaatcactcgtgagactgctcatcgacgggttggaagaacaaga |
47527601 |
T |
 |
| Q |
111 |
gggaaaccttgaactacaatttatggggttctattgtttat-------gcttatgcagtgatttttggggatgatttaannnnnnnnnnnnnnagggatt |
203 |
Q |
| |
|
|| |||||||||| |||||||| | || ||||||||||||| | ||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
47527602 |
ggaaaaccttgaattacaattt-ttggattctattgtttattgcttacgtttatgcaatgatttttggggatgatttaa--ttttctgtttttagggatt |
47527698 |
T |
 |
| Q |
204 |
tgatttacatgcagaatgcataattacagtttctggggttctattgttcttgccttttgg |
263 |
Q |
| |
|
|||| | || ||||||||||||||| | ||||||| ||||||||||| ||||||||||| |
|
|
| T |
47527699 |
tgatgtgcacgcagaatgcataattgaaatttctggagttctattgttattgccttttgg |
47527758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University