View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16483_low_7 (Length: 207)
Name: NF16483_low_7
Description: NF16483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16483_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 20 - 189
Target Start/End: Original strand, 35520843 - 35521012
Alignment:
| Q |
20 |
aggtgcagggaatagcacttgaacaatctttgagtggtcgaaattctccaattcttcccaaagtgttgtcaaatgagagaaataagaagatatatctaag |
119 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35520843 |
aggtggagggaatagcacttgaacaatctttgagtggtcgaaattctccaattcttcccaaagtgttgtcaaatgagagaaataagaagatatgtctaag |
35520942 |
T |
 |
| Q |
120 |
ctaccttgctgatagcgagcaatttattcgagaaggtcagctattctaaagatatcgccgtgtgtgaacc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
35520943 |
ctaccttgctgatagcgagcaatttattcgagaaggtcagcgattctaaagatatcgtcgtgtgtgaacc |
35521012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University