View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16484_high_4 (Length: 259)
Name: NF16484_high_4
Description: NF16484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16484_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 25576906 - 25576663
Alignment:
| Q |
1 |
acagatgatgataaaaatagagtagatatcatgtccttcccaaatcggaaccatcattcaaacatttagcatactaccatatgttacaaacattaactaa |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25576906 |
acagatgatgataaacatagagtagatatcatgtccttcccaaagcggaaccatcattcaaacatttagcatactaccatttgttacaaacattaactaa |
25576807 |
T |
|
| Q |
101 |
gtagatactagaagtcagcaaagcaatttgatgatttaaagtatgatttgttacctgggaaaatctacccacagggcatcatgtgtcagtgtcagctatc |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25576806 |
gtaaatactagaagtcagcaaagcaatttgatgatttaaagtatgatttgttacctgggaaaatctacccacagggcatcatgtgtcagtgtcagctatc |
25576707 |
T |
|
| Q |
201 |
aagagttctcgggactgaattctccccatccactgctacttctt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25576706 |
aagagttctcgggactgaattctccccatccactgctacttctt |
25576663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University