View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16486_high_11 (Length: 417)
Name: NF16486_high_11
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16486_high_11 |
 |  |
|
| [»] scaffold0683 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0683 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0683
Description:
Target: scaffold0683; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 361 - 409
Target Start/End: Original strand, 4866 - 4914
Alignment:
| Q |
361 |
tgatacatatagtgtgaggaagagccatgttaaggaaaatctgatgatg |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
4866 |
tgatacatatagtgtgaggaagagccatgtcaaggaaaatcttatgatg |
4914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University