View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16486_high_14 (Length: 380)
Name: NF16486_high_14
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16486_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 17 - 264
Target Start/End: Original strand, 4403118 - 4403365
Alignment:
| Q |
17 |
catggtccattgtggatcttcctacaggtaaaacttctattggttgtcgttgggtttacaaaatcaaacatcatgttgatggcactattgaacgttaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4403118 |
catggtccattgtggatcttcctacaagtaaaacttctattggttgtcgttgggtttagaaaatcaaacatcatgttgatggcactattgaacgttaaaa |
4403217 |
T |
|
| Q |
117 |
gacacgacttgttgccaaaggatttactcaattagaccggatggactattttgagacctttagtccggttggtcaactcactactgttagagttctcttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4403218 |
gacacgacttgttgccaaaggatttactcaattagaccggatggactattttgagacctttagtccggttggtcaactcactactgttagagttctcttg |
4403317 |
T |
|
| Q |
217 |
gcattggcagctgcaaaaggttggtttttagagcatttagatgtcaat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4403318 |
gcattggcagctgcaaaaggttggtttttagagcatttagatgtcaat |
4403365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 259 - 375
Target Start/End: Original strand, 4403502 - 4403618
Alignment:
| Q |
259 |
gtcaatggaatcataaactgactactattcttctctttttggttagttctcagtctcaagttgaccattctatgttcgtaaaagcctcaacatcgtgttt |
358 |
Q |
| |
|
|||| |||||||||||||| ||||||| |||||||||||||||| ||||||||||||||| ||| |||||||| ||||||||||||||||||||| ||| |
|
|
| T |
4403502 |
gtcattggaatcataaactcactactactcttctctttttggtttgttctcagtctcaagcggactattctatgctcgtaaaagcctcaacatcgtcttt |
4403601 |
T |
|
| Q |
359 |
tgtggctttactagtct |
375 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
4403602 |
tgtggctttactagtct |
4403618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University