View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16486_high_19 (Length: 350)
Name: NF16486_high_19
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16486_high_19 |
 |  |
|
| [»] scaffold0147 (2 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 117 - 350
Target Start/End: Complemental strand, 20735 - 20502
Alignment:
| Q |
117 |
tttgtgtctctgttaggaaaatctgataatgattatgaaaaaagtaataagaatgggaatttgaagaagaaaattgatgaagtgggtgataatgaagagg |
216 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20735 |
tttgtgtctgtgttaggaaaatttgataatgattatgaaaaaagtaataagagtgggaatttgaagaagaaaattgatgaagtgggtgataatgaagagg |
20636 |
T |
 |
| Q |
217 |
agtttttacttgaagagtatgagagtgaagacgagggtagtagtggatcgtcgaagaggaaagcaagtaaaagtggttttagttctacgagtgaagacga |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20635 |
agtttttacttgaagagtatgagagtgaagacgagggtagtagtggagcgtcgaagaggaaagcaagtaaaagtggttttagttctacgagtgaagacga |
20536 |
T |
 |
| Q |
317 |
gtctggtgatgatgaagaagaggaagaggagaag |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20535 |
gtctggtgatgatgaagaagaggaagaggagaag |
20502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 5 - 81
Target Start/End: Complemental strand, 20847 - 20771
Alignment:
| Q |
5 |
gagtgagaagaatgagaatcaaggttcagatgatgaacctgattggatgagagattttgttgtcaacaataatcatc |
81 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20847 |
gagtgggaagaatgagaatcaaggttcagatgatgaacctgattggatgagagattttgtggtcaacaataatcatc |
20771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University