View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16486_high_35 (Length: 251)
Name: NF16486_high_35
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16486_high_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 30311465 - 30311706
Alignment:
| Q |
1 |
ttacaaaatcacgacggctcaatgtgact-tggcaaaccgacagtgatactgaacatgagtggagaattttgactgtgataaggagtggtgtaactggga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30311465 |
ttacaaaatcacgacggctcaatgtgactctggcaaaccgacagtgatactgaacatgagtggagaattttgactgtgataagaagtggtgtaactggga |
30311564 |
T |
|
| Q |
100 |
atattatgcagttggtggttaagagtcaaattttagccggtggacgaggattggggacctttaaaagtggtcttcagggaggagtgcacattgttaagac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30311565 |
ttattatgcagttggtggttaagagtcaaattttagctggtggacgaggattggggacctttaaaagtggtcttcagggaggagtgcacattgttaagac |
30311664 |
T |
|
| Q |
200 |
tgaccaggttgaagatttagctggtaatgcatgatccctttg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30311665 |
tgaccaggttgaagatttagctggtaatgcatgatccctttg |
30311706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University