View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16486_high_38 (Length: 251)
Name: NF16486_high_38
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16486_high_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 41847396 - 41847620
Alignment:
| Q |
18 |
cttggaaacgtgaaaccagtgaaaggagaggcttgtggaaccttcaagtaatggacagcttcttttggtttctcacaagtcatctgtgaggtggatcgca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41847396 |
cttggaaacgtgaaaccagtgaaaggagaggcttgtggaaccttcaagtaatggatagcttcttttggtttctcacaagtcatctgtgaggtggatcgca |
41847495 |
T |
 |
| Q |
118 |
agctagtacttgatcgcattaattgtcaatagtaaatatagatgagatccttactaaattttgtacaacggacggagcagtgcttatgtggttttaccct |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41847496 |
agctagtacttgatcacattaattgtcaatagtaaatatagatgagatccttactaaa-tttgtacaacggacggagcaatgcttatgtggttttaccct |
41847594 |
T |
 |
| Q |
218 |
ccttacaatatttttcatctcactcg |
243 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
41847595 |
ccttacaatatttttcatcacactcg |
41847620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University