View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16486_high_44 (Length: 235)
Name: NF16486_high_44
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16486_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 57 - 225
Target Start/End: Original strand, 50420443 - 50420611
Alignment:
| Q |
57 |
tcctttttgaaggctgacacggatggattactttgaataggacattaattttacatctcttacattttctctttttgctcctgttacattaccatcatca |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50420443 |
tcctttttgaaggctgacacggatggattactttgaattggacattaattttacatctcttacattttctctttttgctcctgttacattaccatcatca |
50420542 |
T |
 |
| Q |
157 |
tagatctataacttttctgtcttttctttatggcttcatatctcacttttccacccatgttgatgatgt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50420543 |
tagatctataacttttctgtcttttctttatggcttcatatctcacttttccacccatgtcgatgatgt |
50420611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University