View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16486_high_44 (Length: 235)

Name: NF16486_high_44
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16486_high_44
NF16486_high_44
[»] chr4 (1 HSPs)
chr4 (57-225)||(50420443-50420611)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 57 - 225
Target Start/End: Original strand, 50420443 - 50420611
Alignment:
57 tcctttttgaaggctgacacggatggattactttgaataggacattaattttacatctcttacattttctctttttgctcctgttacattaccatcatca 156  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50420443 tcctttttgaaggctgacacggatggattactttgaattggacattaattttacatctcttacattttctctttttgctcctgttacattaccatcatca 50420542  T
157 tagatctataacttttctgtcttttctttatggcttcatatctcacttttccacccatgttgatgatgt 225  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
50420543 tagatctataacttttctgtcttttctttatggcttcatatctcacttttccacccatgtcgatgatgt 50420611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University