View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16486_high_45 (Length: 230)
Name: NF16486_high_45
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16486_high_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 6986104 - 6985904
Alignment:
| Q |
14 |
agaagaactatatgctgcagaagattacaactcaacgaagtttttgagcgacagggatcgatatatggagacaattttaggccccagcaatccaaattag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6986104 |
agaagaactatatgctgcagaagattacaactcaacgaagtttttgagcgacagggatcgatatatggagacgattttaggccccagcaatccaaattag |
6986005 |
T |
 |
| Q |
114 |
attatggtttgtgattgattcagatacatagaactacaaaagtttacattaaaggaagtgatgtatatgaatatgagctgattccacttgtggatttagt |
213 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6986004 |
attatggtttgtgattgattcagatgcatagaactacaaaagtttacattaaaggaagtgatgtacatgaatatgagctgattccacttgtggatttagt |
6985905 |
T |
 |
| Q |
214 |
g |
214 |
Q |
| |
|
| |
|
|
| T |
6985904 |
g |
6985904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University