View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16486_low_17 (Length: 378)
Name: NF16486_low_17
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16486_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 15 - 312
Target Start/End: Complemental strand, 35081443 - 35081142
Alignment:
| Q |
15 |
agcataggctgcgtaatattttacatttattgttcttagtttcactcttaagatgaataagtagaaaattctaaattcaaattccggttattaaatatcg |
114 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35081443 |
agcataggctgcgtaaaattttaaatttattatttttagtttcactcttaagatgaataagtagaaaattctaaattcaaatttcggttattaaatatcg |
35081344 |
T |
 |
| Q |
115 |
tagtgcaacaacgtccatgcaaactaggtatgatcacaaagactaattcttgctatttcct--nnnnnnntgagaaagtggtttacatattttatttttc |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35081343 |
tagtgcaacaacgtcgatgcaaactaggtatgatcacaaagactaattcttgctatttcctaaaaaaaaatgagaaagtggtttacatattttatttttc |
35081244 |
T |
 |
| Q |
213 |
tctatcattcctattcttgnnnnnnnnnnnnnnnnngaagaaaatcattcctattcttc---ttgttgttgttatattattttgtgttattaacttatta |
309 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35081243 |
tctatcattcctattcttg-tttttctttttttgttgaagaaaatcattcctattcttcttgttgttgttgttatattattttgtgttattaacttatta |
35081145 |
T |
 |
| Q |
310 |
taa |
312 |
Q |
| |
|
||| |
|
|
| T |
35081144 |
taa |
35081142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 52 - 83
Target Start/End: Complemental strand, 28258047 - 28258016
Alignment:
| Q |
52 |
agtttcactcttaagatgaataagtagaaaat |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28258047 |
agtttcactcttaagatgaataagtagaaaat |
28258016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University