View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16486_low_29 (Length: 290)
Name: NF16486_low_29
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16486_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 158 - 273
Target Start/End: Original strand, 42799989 - 42800104
Alignment:
| Q |
158 |
aagtacaaaaattgattgtaaattttagattcatatgtcttttgatcttttcctcatttttattctgaaagtgaaataattgaattgacaagtgacatat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799989 |
aagtacaaaaattgattgtaaattttagattcatatgtcttttgatcttttcctcatttttattctgaaagtgaaataattgaattgacaagtgacatat |
42800088 |
T |
|
| Q |
258 |
gtatctaaccagatgc |
273 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
42800089 |
gtatctaacctgatgc |
42800104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 17 - 52
Target Start/End: Original strand, 42799947 - 42799982
Alignment:
| Q |
17 |
caggtatcatatcatttttagatatgaaaacactgt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799947 |
caggtatcatatcatttttagatatgaaaacactgt |
42799982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University